Home Liver Diseases Silencing lncRNA Lfar1 alleviates the classical activation and pyoptosis of macrophage in hepatic fibrosis

Silencing lncRNA Lfar1 alleviates the classical activation and pyoptosis of macrophage in hepatic fibrosis

Credits to the Source Link Daniel
Silencing lncRNA Lfar1 alleviates the classical activation and pyoptosis of macrophage in hepatic fibrosis

Antibodies and reagents

Antibodies used for western bloting included F4/80 (rat monoclonal, Abcam, ab16911; 1:200), CD11b (rabbit monoclonal, Abcam, ab133357; 1:1000), LY6C (rat monoclonal, Novus, NBP2-00441; 1:1000), MCP-1 (rabbit polyclonal, Cell Signaling Technology, #2029; 1:1000), NLRP3 (rabbit monoclonal, Cell Signaling Technology, #15101; 1:1000), pro-Caspase1 (rabbit monoclonal, Abcam, ab179515; 1:1000), GSDMD (rabbit monoclonal, Abcam, ab209845; 1:1000), IKK (rabbit monoclonal, Abcam, ab178870; 1:1000), phospho-IKK (rabbit monoclonal, Cell Signaling Technology, #2697; 1:1000), p65 (mouse monoclonal, Sabta cruz, sc-8008; 1:200), phospho-p65 (rabbit monoclonal, Cell Signaling Technology, #3033; 1:1000), IĸBα (mouse monoclonal, Cell Signaling Technology, #9246; 1:1000), phospho-IĸBα (mouse monoclonal, Cell Signaling Technology, #4814; 1:1000), GAPDH (mouse monoclonal, Abcam, ab8245; 1:8000), Goat Anti-Mouse IgG (Abcam, ab97023; 1:10000), Goat Anti-Rabbit IgG (Abcam, ab97051; 1:10000) and Goat Anti-Rat IgG (Abcam, ab97057; 1:10000). Antibodies used for immunohistochemistry and immunohistochemistry-frozen included F4/80 (rat monoclonal, Abcam, ab16911; 1:50) and LY6C (rat monoclonal, Novus, NBP2-00441; 1:200). LPS, IFN-γ, IL-4, IL-10 and M-CSF were purchased from PeproTech, ATP and nigericin were purchased from Med Chem Express.

Cell culture and treatments

The murine immortalized macrophages RAW264.7 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Camarillo, CA) supplemented with 10% fetal bovine serum (FBS, Gibco, Gaithersburg, MD, USA), penicillin (100 U/ml) and streptomycin (100 μg/ml). Bone marrow-derived macrophages (BMMs) were isolated from the femur and tibia of C57BL/6 mice (8–9 weeks) cultured in DMEM containing 10% FBS, penicillin (100 U/ml) and streptomycin (100 μg/ml) and 10 ng/mL murine M-CSF (Peprotech) for 6 days. Medium was changed every 2-day. Primary mouse KCs were isolated by pronase/collagenase perfusion digestion followed by subsequent density gradient centrifugation, as previously described. Magnetic cells sorting (MACS)-based positive selection using a F4/80 antibody (eBioscience) and or selective adhesion was further employed to purify KCs. RAW264.7 cells, BMMs and KCs were polarized into an M1 or M2 phenotype using 20 ng/ml INF-γ and 100 ng/ml LPS or 20 ng/ml IL-4, 20 ng/ml IL-10, respectively. Cells were primed with 100 ng/ml LPS for 4 h, and subsequently stimulated with 10 μM Nigericin or 5 mM ATP for 2 h to induce pyroptosis.

Cell transfection

For gene knockdown analysis, siRNAs targeting the lnc-Lfar1 and and non-targeting siRNA (si-NC) were obtained from GenePharma Biological Technology (Shanghai, China). Cells were transfected with the siRNAs at 50% confluence using lipofectamine MAX according to the manufacturer’s instructions (Invitrogen, Grand Island, NY, USA). After culturing for 24–48 h, cells were analyzed by real-time PCR to determine knockdown efficiency. Target sequences of these siRNA were as follows: si-lnc-Lfar1-1: GGUCACGAUUCAUCUGAAATT; si-lnc-Lfar1-2: GGACCUCAUCUGUAAUGAATT; si-lnc-Lfar1-3: GAUCCUAUUAAACCGCUUATT; si-NC: GUUCUCCGAACGUGUCACGTT.

Animal model and treatment

The CCl4– and BDL-induced mouse liver fibrosis model was previously described19. Animal protocols were approved by Tianjin Medical University Animal Care and Use Committee. The methods were carried out in accordance with the approved guidelines. All Balb/c mice aged at 8 weeks obtained from Institute of Laboratory Animal Sciences, CAMS & PUMC (Beijing, China).

Immunohistochemistry

The specimens were sequentially fixed in 10% formalin for two days, transferred to ethanol of different concentration and embedded in paraffin in preparation for immunohistochemical analysis. Briefly, sections prepared on slides were first submitted to antigen retrieval by incubation in citrate buffer (pH 6.0) for 5 min at 108 °C and pretreated with 3% H2O2 for 15 min at room temperature followed by washing with PBS. Slides were subsequently incubated in normal goat serum for 20 min to block the nonspecific immunoreactivity. Next, the slides were treated with primary antibody overnight at 4 °C. The slides were incubated with secondary antibody (1:500) (HRP-conjugated anti-rabbit IgG). And the reaction products were visualized using diaminobenzidine (DAB) and monitored by microscopy.

Confocal microscopy

Confocal immunofluorescent analysis was performed as described previously19,28. Antibodies used for confocal microscopy included F4/80 (rat monoclonal, Abcam, ab16911; 1:50), VEGFR2 (rabbit monoclonal, Cell Signaling Technology, #9698; 1:500), α-SMA (rabbit polyclonal, Abcam, ab5694; 1:100), p65(mouse monoclonal, Sabta cruz, sc-8008; 1:50), p50 (rabbit monoclonal, Cell Signaling Technology, #13586; 1:200) and goat anti rabbit/mouse/rat IgG (Life Technologies, Alexa Fluor 594; 1:500). All immunofluorescence was then visualized by a confocal microscope (LSM 700) or a fluorescence microscope.

ELISA and LDH assay

Levels of IL-1β, IL-18 and LDH in cell cultured supernatants and liver tissue extracts were assessed using commercial assay kits (Nanjing Jiancheng, Nanjing, China) according to the manufacturer’s protocols.

Western blot analysis

Immunoblotting analysis was performed as described previously19,28.

Quantitative real-time polymerase chain reaction

Total RNA extracted from liver tissues or cells with Trizol reagent (Takara, Dalian, China). All RNA was digested with DNase I (Takara, Dalian, China). For real-time PCR, all reactions were performed in triplicate with SYBR Green master mix (Takara, Dalian, China) according to the manufacturer’s instructions. The expression level of housekeeping gene GAPDH was used to normalize the expression level of the genes-of-interest. Primers sequences for mouse genes were Gapdh sense 5′-GGCATGGACTGTGGTCATGAG-3′ and antisense 5′-TGCACCACCAA-CTGCTTAGC-3′; lnc-Lfar1 sense 5′-GCCAGCACACTAAAGACGAG-3′ and antisense 5′-GCAAAGGTGGAGGTCAGATT-3′; Ly6C sense 5′-GCAGTGCTACGAGTGCTATGG-3′ and antisense 5′-ACTGACGGGTCTTTAGTTTCCTT-3′; F4/80 sense 5′-TGACTCACCTTGTGGTC-CTAA-3′ and antisense 5′-CTTCCCAGAATCCAGTCTTTCC-3′; Ccr2 sense 5′-ATGCAAG-TTCAGCTGCCTGC-3′ and antisense 5′-ATGCCGTGGATGAACTGAGG-3′; Cd206 sense 5′-GTGGAGTGATGGAACCCCAG-3′ and antisense 5′-CTGTCCGCCCAGTATCCATC-3′; Arg1 sense 5′-ACATTGGCTTGCGAGACGTA-3′ and antisense 5′-ATCACCTTGCCAATCCCCAG-3′; Tnf-α sense 5′-CATCTTCTCAAAATTCGAGTGACAA-3′ and antisense 5′-TGGGAGTAGACA-AGGTACAACCC-3′; Il-1β sense 5′-GTCGCTCAGGGTCACAAGAA-3′ and antisense 5′-GTG-CTGCCTAATGTCCCCTT-3′; Mcp-1 sense 5′-GTTAACGCCCCACTCACCTG-3′ and antisense 5′-GGGCCGGGGTATGTAACTCA-3′; iNos sense 5′-CAGGGCCACCTCTACATTTG-3′ and antisense 5′- TGCCCCATAGGAAAAGACTG -3′; Il-6 sense 5′-AGTTGCCTTCTTGGGACTGA-3′ and antisense 5′-TCCACGATTTCCCAGAGAAC-3′; Ccl5 sense 5′-CCACTTCTTCTCTGGG-TTGG-3′ and antisense 5′-GTGCCCACGTCAAGGAGTAT-3′; Cxcl5 sense 5′-TGCATTCCGCTTAGCTTTCT-3′ and antisense 5′-CAGAAGGAGGTCTGTCTGGA-3′; Cxcl9 sense 5′-TCTTGGGCATCATCTTCCTGG-3′ and antisense 5′-GAGGTCTTTGAGGGATTTGT-AGTGG-3′; Cxcl10 sense 5′-GATGACGGGCCAGTGAGAAT-3′ and antisense 5′-CTCAACA-CGTGGGCAGGATA-3′; Nlrp3 sense 5′-CGGATGTTATTCTGGCAACA-3′ and antisense 5′-CGCTTTGGAGATGGATCTGT-3′; Pro-Caspase1 sense 5′-AGATGGCACATTTCCAGGAC-3′ and antisense 5′- GATCCTCCAGCAGCAACTTC -3′; Asc sense 5′-TGACAGTGCAACTGCGA-GAA-3′ and antisense 5′-GTGAGCTCCAAGCCATACGA-3′; Il-18 sense 5′-CACTTCTC-CCCTGTGGTGTG-3′ and antisense 5′-GGCAGGAGTCCAGAAAGCAT-3′; Gsdmd sense 5′-GCTCTATGCCTCCCTGTTCC-3′ and antisense 5′-TTCTACCTTGGCTGGAGGGT-3′; Tlr4 sense 5′-TTTGCTGGGGCTCATTCACT-3′ and antisense 5′-GACTCGGCACTTAGCACTGT-3′; Myd88 sense 5′-CTCGCAGTTTGTTGGATGCC-3′ and antisense 5′-GGCCACCTGTAAA-GGCTTCT-3′; Ikk1 sense 5′-GTTCTGCCCGCTCTCTTGTA-3′ and antisense 5′- TCACACA-TGTCAGAGGATGTTCA-3′; Ikk2 sense 5′-GTGCCTGTGACAGCTTACCT-3′ and antisense 5′-ACTGCGTTTGCACTTTTGCT-3′; Ifnγr1 sense 5′-ACGGTGATCTGTGAAGAGCC-3′ and antisense 5′-TTTGTGTCGGAGTTGGAGGG-3′.

Statistical analysis

Data were expressed as mean ± SD. All the statistical analyses were performed with the SPSS 13.0 (IBM, Armonk, NY, USA). Statistical analyses were performed using either Student’s t-test (two-group comparison) or one-way analysis of variance (more than two groups) followed by post hoc comparison, and differences with p < 0.05 were considered significantly.

Source Link

Related Articles

Leave a Comment

This website uses cookies to improve your experience. We will assume you are ok with this, but you can opt-out if you wish. Accept Read More

%d bloggers like this: