Home Journals Krüppel-like Factor 5 Regulates Stemness, Lineage Specification, and Regeneration of Intestinal Epithelial Stem Cells

Krüppel-like Factor 5 Regulates Stemness, Lineage Specification, and Regeneration of Intestinal Epithelial Stem Cells

Credits to the Source Link Daniel
Large image of abstract-image.

Intestinal stem cells are required for proliferation, differentiation, and regeneration of the intestinal epithelium. Krüppel-like factor 5 regulates intestinal stem cells in both physiologic and pathological conditions and may be a treatment target in certain diseases of the intestine.

The intestinal epithelium is replenished every 3–5 days and is driven by Lgr5+ intestinal stem cells (ISCs) at the crypt bottom.1x1Barker, N. Adult intestinal stem cells: critical drivers of epithelial homeostasis and regeneration. Nat Rev Mol Cell Biol. 2014;
15: 19–33
Crossref | PubMed | Scopus (486)
| Google ScholarSee all References

Krüppel-like zinc-finger transcription factor (TF) KLF5 is expressed in both ISCs and transit-amplifying (TA)13x13Kim, C.K., He, P., Bialkowska, A.B., and Yang, V.W. SP and KLF transcription factors in digestive physiology and diseases. Gastroenterology. 2017;
152: 1845–1875
Abstract | Full Text | Full Text PDF | PubMed | Scopus (17)
| Google ScholarSee all References
,14x14Nandan, M.O. and Yang, V.W. The role of Kruppel-like factors in the reprogramming of somatic cells to induced pluripotent stem cells. Histol Histopathol. 2009;
24: 1343–1355
PubMed
| Google ScholarSee all References
,15x15Nandan, M.O., Ghaleb, A.M., Bialkowska, A.B., and Yang, V.W. Kruppel-like factor 5 is essential for proliferation and survival of mouse intestinal epithelial stem cells. Stem Cell Res. 2015;
14: 10–19
Crossref | PubMed | Scopus (14)
| Google ScholarSee all References
cells and regulates epithelial proliferation, differentiation, and development.13x13Kim, C.K., He, P., Bialkowska, A.B., and Yang, V.W. SP and KLF transcription factors in digestive physiology and diseases. Gastroenterology. 2017;
152: 1845–1875
Abstract | Full Text | Full Text PDF | PubMed | Scopus (17)
| Google ScholarSee all References

To determine KLF5’s functions in ISCs, we investigated Lgr5EGFP-IRES-creERT2;Rosa26LSLtdTomato (Lgr5Ctrl) and Lgr5EGFP-IRES-creERT2;Klf5fl/fl;Rosa26LSLtdTomato (Lgr5ΔKlf5) mice following tamoxifen-induced activation of Cre recombinase. Surprisingly, absence of KLF5 increased ISC proliferation and induced premature enterocyte differentiation, with attendant loss of ISC identity. KLF5 is also required for the regeneration of the intestinal epithelium in response to radiation injury. Global gene analyses revealed a role of KLF5 in controlling both epigenetic and transcriptional activities of ISC-specific gene sets, including selected key elements related to WNT and NOTCH signaling. These findings identify a novel molecular mechanism by which a tissue-restricted TF maintains ISC identity and functions.

Results

KLF5 Deficiency Accelerates ISC Proliferation, Inhibits Self-Renewal, and Impairs Crypt Cell Dedifferentiation

To investigate the role of KLF5 in regulating ISC self-renewal and maintenance, we injected Lgr5Ctrl and Lgr5ΔKlf5 mice with tamoxifen for 5 consecutive days to activate Cre recombinase and 5-ethynyl-2′-deoxyuridine (EdU) to selectively label cells in S-phase (Figure 1A). In Lgr5Ctrl mice or Lgr5ΔKlf5 mice before tamoxifen administration, KLF5 is expressed in both ISCs (Figure 1B, magenta arrowheads) and the TA zone of progenitor cells (Figure 1B, yellow brackets). Over a 12-day period following the initial tamoxifen treatment, the crypts of Lgr5ΔKlf5 mice showed a progressive loss of Lgr5EGFP+ ISCs (Figures 1B and 1C) and reduced expansion of EdU+RFP+ crypt cells (Figures 1D and 1E) when compared with control mice. Using a 3-hour EdU pulse treatment, we found at all studied time points that approximately 20% of Lgr5+ cells were in S-phase in Lgr5Ctrl mice (Figures 2A and 2B). In contrast, between 2 and 5 days after Klf5 deletion, up to 35% of Lgr5+ cells incorporated EdU (Figures 2A and 2B). This difference in cell proliferation between Lgr5Ctrl and Lgr5ΔKlf5 mice was no longer apparent after day 9, possibly because the number of Lgr5+ cells was significantly reduced (Figure 1C) and replaced by KLF5-expressing Lgr5EGFP+ cells that had escaped Cre recombination (Figure 2C).

Figure 1

KLF5 is required for intestinal stem cell self-renewal. (A) Scheme of the experimental plan. Eight- to 12-week-old Lgr5Ctrl and Lgr5ΔKlf5 mice were injected with tamoxifen for 5 consecutive days and sacrificed at 0, 2, 5, 9, 12,19, 33, or 61 days after the first injection. Mice were injected with EdU 3 or 24 hours before sacrifice. Lgr5EGFPhi cells were FACS-isolated for 3-dimensional enteroid culture, RNA-seq, and ChIP-seq at day 5. (B) Representative immunofluorescence images of EGFP, RFP, KLF5, and DAPI in the PSI crypts of Lgr5Ctrl and Lgr5ΔKlf5 mice. KLF5 expression was observed in Lgr5EGFPhi cells at the base of the crypts (magenta arrowheads), as well as cells in the TA zone (yellow brackets). Scale bars represent 20 μm. (C) Quantification of average number of Lgr5EGFPhi cells per crypt. (D) Representative immunofluorescence images of RFP, KLF5, EdU, and DAPI of PSI crypts of Lgr5Ctrl and Lgr5ΔKlf5 mice. Mice were treated with 3 hours EdU pulse. Scale bar represents 20 μm. (E–G) Quantification of (E) EdU-incorporated RFP+, (F) an average number of RFP+, and (G) total cells per crypt. Data are expressed as mean ± SD, 20 crypts quantified per mouse (E–G), n = 3–5 mice per group. ∗P < .05, ∗∗P < .01 by linear mixed regression models.

 Opens large image

Figure 2

KLF5 regulates proliferation of intestinal stem cells. (A) Representative immunofluorescence (IF) images of EGFP, EdU, KLF5, and DAPI of PSI crypts after 3 hours EdU pulse treatment at day 0, 2, 5, 9, and 12 after tamoxifen injections. Scale bar represents 20 μm. (B, C) Quantification of percent (B) EdU-incorporated or (C) KLF5-expressing Lgr5EGFP+ cells. (D) Representative IF images of EGFP, EdU, KLF5, and DAPI of the PSI crypts after 3 or 24 hours of pulse EdU treatment at day 5. EGFP+EdU+ cells are marked with yellow arrowheads. Scale bars represent 20 μm. (E) Quantification of percent of EdU-incorporated Lgr5EGFP+ cells. (F) Representative IF images of EGFP, RFP, KLF5, and DAPI of PSI crypt-villus axis of Lgr5Ctrl and Lgr5ΔKlf5 mice at 5, 9, and 12 days after the first tamoxifen injection. Scale bar represents 50 μm. Data are represented as mean ± SD, 250 cells quantified per mouse, n = 4–5 mice per group. ∗P < .05 by Mann-Whitney U test.

As increased EdU incorporation in Lgr5+ cells upon loss of KLF5 implies a faster rate of ISC proliferation, we traced the fate of ISC division after 3-hour and 24-hour EdU pulse treatments. In Lgr5Ctrl mice, the fraction of EdU-labeled Lgr5+ ISCs increased from 18.4 ± 0.6% at 3 hours to 31.1 ± 2.4% at 24 hours (Figures 2D and 2E, yellow arrowheads), providing evidence for self-renewal. This is confirmed by the significantly higher number of RFP+ progenitors within the crypts, from day 2 to 5, in Lgr5Ctrl mice (Figure 1F). In contrast, the proportion of EdU-labeled Lgr5+ cells in Lgr5ΔKlf5 mice decreased from 35.7 ± 3.4% at 3 hours to 17.9 ± 1.6% at 24 hours (Figures 2D and 2E), suggesting that self-renewal of ISCs is impaired, which leads to reduced numbers of Lgr5+ ISCs from the crypt base. These findings indicate that absence of KLF5 accelerates ISC division and reduces self-renewal, leading to ISC exhaustion. Importantly, these ISC functions contrast with those in crypts at large, where absence of KLF5 impairs cell replication.15x15Nandan, M.O., Ghaleb, A.M., Bialkowska, A.B., and Yang, V.W. Kruppel-like factor 5 is essential for proliferation and survival of mouse intestinal epithelial stem cells. Stem Cell Res. 2015;
14: 10–19
Crossref | PubMed | Scopus (14)
| Google ScholarSee all References

Although Klf5-deleted ISCs proliferate faster, generation of the lineage was stunted during the first 12 days, as evidenced by the scarcity of RFP+ cells within villi compared with Lgr5Ctrl mice (Figure 2F). Crypt cells, which predominantly drive tissue renewal, showed reduced EdU incorporation after Klf5 deletion (Figures 1D and 1E). Whereas RFP+ cells replaced most crypt cells in Lgr5Ctrl mice by day 5, lineage tracing by Klf5-deleted RFP+ cells was slower (Figures 1D and 1F). However, the total number of crypt cells from day 2 to 12 was similar between Lgr5Ctrl and Lgr5ΔKlf5 mice (Figure 1G).

To determine long-term effects of KLF5 loss on the tissue lineage, we traced GFP+ and RFP+ cells for 19, 33, and 61 days following tamoxifen treatment. Klf5-null RFP+ crypts were rapidly depleted (Figures 3A and 3B) and the few residual crypts at day 61 were diminutive and devoid of Lgr5EGFP+ ISCs (Figure 3A, yellow arrowheads). KLF5-expressing RFPLgr5EGFP+ cells appeared in Lgr5ΔKlf5 mice starting at day 12 (Figure 3A, magenta arrowheads; and Figure 3C [such cells were infrequent in Lgr5Ctrl mice]). Furthermore, residual Klf5-null RFP+ crypts continued to incorporate EdU (Figure 3D) and terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining revealed absence of apoptosis (Figure 3E). Together, these findings imply that crypt loss resulted from impaired ISC self-renewal and impaired ability of Klf5-null progenitors to dedifferentiate in response to ISC attrition.

 Opens large image

Figure 3

KLF5 is required for long-term intestinal stem cell survival. (A) Representative immunofluorescence images of EGFP, RFP, KLF5, and DAPI of PSI crypts of Lgr5Ctrl and Lgr5ΔKlf5 mice scarified at day 19, 33, or 61. Yellow arrowheads mark RFP+ crypts. Magenta arrowheads mark crypts with non-RFP, Lgr5EGFPhi cells. Scale bar represents 20 μm. (B, C) Quantification of the percentage of (B) RFP+ crypts and (C) crypts with non-RFP, Lgr5EGFPhi cells of Lgr5Ctrl and Lgr5ΔKlf5 mice at 5, 12, 19, 33, and 61 days. Data are expressed as mean ± SD, n = 3–6 mice per group. ∗P < .05 by Mann-Whitney U test. (D, E) Representative immunofluorescence images of RFP, KLF5, DAPI, and (D) EdU or (E) TUNEL of PSI crypts of Lgr5Ctrl and Lgr5ΔKlf5 mice injected with 3 hours EdU pulse treatment at day 19. Scale bar represents 20 μm.

KLF5 Is Required for ISC Clonal Expansion

To test the ability of ISCs to expand clonally in 3D enteroid cultures in the absence of KLF5, we isolated Lgr5EGFPhi cells from Lgr5Ctrl and Lgr5ΔKlf5 mice (Figures 4A and 4B). We did so on day 5 after tamoxifen treatment, based on the high recombination efficiency and strong in vivo phenotypes evident at this time (Figures 1 and 2). Approximately 1% of control Lgr5EGFPhi cells formed enteroids by day 6, while Klf5-null cells expanded briefly but failed to form typical, mature enteroids (Figures 4C, 4D, and 4E). A majority of Klf5-deleted cells incorporated EdU on the second day of ex vivo culture, and the average number of nuclei was higher than in control cultures (Figures 4F and 4G), but EdU incorporation ceased by day 6 (Figure 4F). Moreover, staining with CC3 on day 8 of culture showed absence of apoptosis in the arrested enteroids derived from Lgr5ΔKlf5 cells (Figure 4H). These data confirm that Klf5 deletion initially accelerates ISC proliferation, but the cells subsequently fail at clonal expansion.

 Opens large image

Figure 4

Loss of KLF5 in Lgr5EGFP+cells impairs clonal expansion of ISCs in 3D enteroid culture. (A) FACS isolation of RFP-expressing Lgr5EGFPhi and Lgr5EGFPlo cells. Rosa26LSLtdTomato mice were used as negative control. (B) RT-qPCR analysis of Lgr5 in Lgr5EGFPhi or Lgr5EGFPlo populations of Lgr5Ctrl mice after the sorting. (C) Representative bright field and RFP images of enteroid culture at day 6. Magenta arrowheads mark Klf5-deleted cell clumps. Scale bar represents 200 μm. (D) Quantification of the percent enteroid formation. (E) Representative images of enteroids at culture day 2, 4, 6, and 8. (F) Representative confocal images of EdU, KLF5, and DAPI of enteroids treated with EdU 3 hours before formalin fixation. Scale bar represents 20 μm. (G) Quantification of the number of nuclei per enteroids at day 2 of culture. (H) Representative immunofluorescence images of CC3 and DAPI of enteroid at day 8. Scale bar represent 50 μm. Data are represented as mean ± SD, n = 3–6 mice per group, ∗P < .05, **P < .01 by (B, G) Mann-Whitney U test or (D) linear mixed regression models.

KLF5 Deficiency Results in Premature ISC Differentiation

To define the transcriptional impact of Klf5 loss in Lgr5+ ISCs, we profiled the transcriptomes of Lgr5EGFPhi cells isolated from Lgr5Ctrl and Lgr5ΔKlf5 mice and observed differences in 2209 protein-coding genes (log2 fold-change >|1.5|; 1064 upregulated; 1145 downregulated) at a false discovery rate <.05 (Supplementary Table S1xpdf iconDownload
(5.72 MB
)


Supplementary Table S1). Control and mutant cells clustered distinctly (Figures 5A and 5B), and by Gene Ontology analysis, genes upregulated in Klf5-null cells display metabolic functions associated with villus differentiation,21x21Mariadason, J.M., Nicholas, C., L’Italien, K.E., Zhuang, M., Smartt, H.J., Heerdt, B.G., Yang, W., Corner, G.A., Wilson, A.J., Klampfer, L., Arango, D., and Augenlicht, L.H. Gene expression profiling of intestinal epithelial cell maturation along the crypt-villus axis. Gastroenterology. 2005;
128: 1081–1088
Abstract | Full Text | Full Text PDF | PubMed | Scopus (149)
| Google ScholarSee all References

 Opens large image

Figure 5

Loss of KLF5 modifies transcriptome of Lgr5EGFPhiintestinal stem cells. (A) Principal component analysis (PCA) plot of RNA-seq analysis of FACS-isolated Lgr5EGFPhi cells from Lgr5Ctrl and Lgr5ΔKlf5 mice, n = 3. (B) Heatmap analysis of RNA-seq data. (C) Top 10 significant Gene Ontology terms of biological processes from differentially expressed genes. (D-E) GSEA. Intestinal stem cell signature genes23x23Munoz, J., Stange, D.E., Schepers, A.G., van de Wetering, M., Koo, B.K., Itzkovitz, S., Volckmann, R., Kung, K.S., Koster, J., Radulescu, S., Myant, K., Versteeg, R., Sansom, O.J., van Es, J.H., Barker, N., van Oudenaarden, A., Mohammed, S., Heck, A.J., and Clevers, H. The Lgr5 intestinal stem cell signature: robust expression of proposed quiescent ‘+4’ cell markers. EMBO J. 2012;
31: 3079–3091
Crossref | PubMed | Scopus (390)
| Google ScholarSee all References

 Opens large image

Figure 6

KLF5 is required to preserve the intestinal stem cell transcriptome of Lgr5EGFP+cells to prevent premature differentiation. (A, B) RT-qPCR analysis of genes in FACS-isolated Lgr5EGFPhi cells from Lgr5Ctrl and Lgr5ΔKlf5 mice. Data are represented as mean ± SD, n = 4–6, ∗P < .05, ∗∗P < .01 by Mann-Whitney U test. (C) RT-qPCR analysis of genes in FACS-isolated Lgr5EGFPlo cells (early progenitors) from Lgr5Ctrl and Lgr5ΔKlf5 mice. Data are represented as mean ± SD, n = 4–6, ∗P < .05, ∗∗P < .01, ∗∗∗P < .001 by Mann-Whitney U test. (D) Representative immunofluorescence images of Villin1 and DAPI of day 8 enteroids cultured from FACS-isolated Lgr5EGFPhi cells from Lgr5Ctrl and Lgr5ΔKlf5 mice. Scale bars represent 50 μm. (E) Representative confocal images of MUC2, CHGA, or LYZ with F-actin and DAPI of day 8 enteroids. Scale bars represent 25 μm.

KLF5 Maintains H3K27ac at Genomic Loci Associated With ISC Gene Expression

TFs occupy their target gene promoters and enhancers marked by active histone marks, such as H3K27ac.25x25Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., Boyer, L.A., Young, R.A., and Jaenisch, R. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 2010;
107: 21931–21936
Crossref | PubMed | Scopus (1730)
| Google ScholarSee all References

 Opens large image

Figure 7

Loss of Klf5 in intestinal stem cells leads to depletion of H3K27ac at genomic loci. (A) Genome-wide differential H3K27ac analysis27x27Shen, L., Shao, N.Y., Liu, X., Maze, I., Feng, J., and Nestler, E.J. diffReps: detecting differential chromatin modification sites from ChIP-seq data with biological replicates. PLoS One. 2013;
8: e65598
Crossref | PubMed | Scopus (115)
| Google ScholarSee all References

 Opens large image

Figure 8

Depletion of H3K27ac associates with downregulated gene expression upon loss of Klf5. (A) BETA (binding and expression target analysis)31x31Wang, S., Sun, H., Ma, J., Zang, C., Wang, C., Wang, J., Tang, Q., Meyer, C.A., Zhang, Y., and Liu, X.S. Target analysis by integration of transcriptome and ChIP-seq data with BETA. Nat Protoc. 2013;
8: 2502–2515
Crossref | PubMed | Scopus (135)
| Google ScholarSee all References

ISC self-renewal depends on WNT and NOTCH signaling,30x30Tian, H., Biehs, B., Chiu, C., Siebel, C.W., Wu, Y., Costa, M., de Sauvage, F.J., and Klein, O.D. Opposing activities of Notch and Wnt signaling regulate intestinal stem cells and gut homeostasis. Cell Rep. 2015;
11: 33–42
Abstract | Full Text | Full Text PDF | PubMed | Scopus (86)
| Google ScholarSee all References

 Opens large image

Figure 9

H3K27ac-depleted regions enrich for NOTCH and WNT signaling pathway genes. (A) GSEA shows enrichment of NOTCH pathway genes in control Lgr5-EGFPhi cells. Representative tracks for ChIP-seq,28x28Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y., and Greenleaf, W.J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 2013;
10: 1213–1218
Crossref | PubMed | Scopus (1572)
| Google ScholarSee all References

KLF5 Is Required for the Regenerative Response After Irradiation Injury

Intestinal epithelial regeneration following 12-Gy γ-irradiation injury in mice can be divided into 3 phases: apoptosis (0–48 hours), regeneration (72–96 hours), and normalization (after 96 hours).4x4Kim, C.K., Yang, V.W., and Bialkowska, A.B. The Role of Intestinal Stem Cells in Epithelial Regeneration Following Radiation-Induced Gut Injury. Curr Stem Cell Rep. 2017;
3: 320–332
Crossref | PubMed | Scopus (14)
| Google ScholarSee all References

 Opens large image

Figure 10

Loss of KLF5 in intestinal stem cells and progenitors impairs the regenerative response of intestinal epithelial cells following γ-irradiation injury. (A) Experimental timeline. Lgr5Ctrl and Lgr5ΔKlf5 mice were injected with tamoxifen for 5 consecutive days and irradiated with 12-Gy γ-irradiation. (B) Representative immunofluorescence images of RFP, KLF5, EdU, and DAPI in the PSI crypts of Lgr5Ctrl and Lgr5ΔKlf5 mice treated with 3 hours EdU pulse. (C, D) Quantification of number of RFP+ cells (C) and EdU-incorporated RFP+ cells (D) per crypt. Scale bars represent 20 μm. Data are represented as mean ± SD, n = 4–5 mice per group, *P < .05, **P < .01 by (C, D) linear mixed regression models.

 Opens large image

Figure 11

KLF5 controls both short- and long-term regenerative response following radiation injury. (A) Representative immunofluorescence (IF) images of TUNEL, RFP, KLF5, and DAPI of the PSI crypts of Lgr5Ctrl and Lgr5ΔKlf5 mice 0, 6, 24, 36, or 48 hours following 12-Gy γ-irradiation. (B) Quantification of number of apoptotic RFP+ cells per crypt. Data are represented as mean ± SD, 20 crypts quantified per mouse, n = 3–5 mice per group. ∗P < .05 by linear mixed regression model. (C) Representative IF images of EGFP, RFP, KLF5, and DAPI in the PSI crypts of Lgr5Ctrl and Lgr5ΔKlf5 mice 4 days after γ-irradiation injury. (D) Quantification of percent regenerating RFP+ crypts in PSI of Lgr5Ctrl and Lgr5ΔKlf5 mice at day 4 after γ-irradiation injury. Data are represented as mean ± SD, n = 4–5 mice per group, *P < .05, **P < .01 by linear-mixed regression models Mann-Whitney U test. (E) Representative IF images of EGFP, RFP, KLF5, and DAPI of the PSI crypts of Lgr5Ctrl mice at day 7 postirradiation. Scale bars represent 20 μm.

 Opens large image

Figure 12

Increased KLF5 levels in the regions of human intestinal epithelium after radiation injury as compared with control. Representative images of (A, C, E) H&E and (B, D, F) and insets KLF5 immunohistochemistry stain from control human intestinal tissues. The control tissues have been characterized as benign/normal with no active disease (either Crohn’s disease, ulcerative colitis or colon cancer) by a pathologist. (G, I,K) H&E stain of regions of colonic or intestinal epithelium after radiation treatment, (H, J, L) with insets KLF5 immunohistochemistry stain of regions of colonic or intestinal epithelium after irradiation. The tissues shown were given the diagnosis of (G, H) radiation colitis, (I, J) radiation enteritis, and (K, L) radiation colitis. Scale bar = 100 μM.

Discussion

We report that KLF5 controls ISC proliferation and stemness, preventing their premature differentiation along the enterocyte lineage. Because previous studies implicate KLF5 in promoting intestinal epithelial cell proliferation,15x15Nandan, M.O., Ghaleb, A.M., Bialkowska, A.B., and Yang, V.W. Kruppel-like factor 5 is essential for proliferation and survival of mouse intestinal epithelial stem cells. Stem Cell Res. 2015;
14: 10–19
Crossref | PubMed | Scopus (14)
| Google ScholarSee all References

Moreover, KLF5 is expressed in the majority of crypt cells, which have shown to contribute to tissue regeneration postinjury,41x41Santos, A.J.M., Lo, Y.H., Mah, A.T., and Kuo, C.J. The intestinal stem cell niche: homeostasis and adaptations. Trends Cell Biol. 2018;
28: 1062–1078
Abstract | Full Text | Full Text PDF | PubMed | Scopus (13)
| Google ScholarSee all References

Accessible chromatin and active histone modifications, such as H3K27ac, mark TF-bound cis-elements that control cell-specific genes. KLF5-dependent genes were strongly correlated with KLF5-dependent enhancers enriched for the cognate binding motif, indicating that at least part of KLF5’s mechanism is to maintain TF access and active histone marks at selected ISC enhancers. Among the panoply of bona fide target genes, KLF5-dependent enhancers control selected genes in the WNT and NOTCH pathways. KLF5 thus maintains stem cell homeostasis in part by preserving cis-regulatory elements upstream of these ISC signals, which may be also required in the dedifferentiation process post-injury. In contrast, genes that gain expression in Klf5-null ISCs are mature villus genes associated with enhancers that lack KLF5 motif enrichment, and these are likely not direct transcriptional targets. Furthermore, we observed that Klf5-null ISCs fail to produce secretory lineages in the context of reduction of NOTCH signaling and WNT target genes in ISCs. As we observed a reduction in Atoh1 expression while Hes1 expression did not change in Lgr5EGFPlo cells, it is possible that KLF5 has unique functions in precursors and would be of interest to explore its potential role in lineage determination of precursors.

In summary, our study has shown that KLF5 is required for ISC identity and functions through preserving cis-regulatory elements of ISC genes to regulate transcription, and is required in tissue regeneration postinjury and dedifferentiation of precursors into ISCs.

Materials and Methods

All authors had access to the study data and had reviewed and approved the final manuscript.

Mice

Klf5fl/fl,44x44Shindo, T., Manabe, I., Fukushima, Y., Tobe, K., Aizawa, K., Miyamoto, S., Kawai-Kowase, K., Moriyama, N., Imai, Y., Kawakami, H., Nishimatsu, H., Ishikawa, T., Suzuki, T., Morita, H., Maemura, K., Sata, M., Hirata, Y., Komukai, M., Kagechika, H., Kadowaki, T., Kurabayashi, M., and Nagai, R. Kruppel-like zinc-finger transcription factor KLF5/BTEB2 is a target for angiotensin II signaling and an essential regulator of cardiovascular remodeling. Nat Med. 2002;
8: 856–863
Crossref | PubMed | Scopus (284)
| Google ScholarSee all References

Samples From Patients

Surgical specimens of resected colorectal cancer specimen obtained from Stony Brook University and SUNY Downstate were used in this study. A total of 17 specimens were processed for H&E and immunohistochemistry. The protocol for the sample collection has been originally approved by the Institutional Review Board by the State University of New York at Stony Brook on October 17, 2014 (CORIHS 2014-2821-F) and qualified for a waiver under the Federal Law of Department of Health and Human Services per article 45CFR46.116.d.

H&E Staining

Histology of sections was observed on stained 5-μm sections that were fixed, paraffin embedded, deparaffinized, and rehydrated, as mentioned previously. Then, they were stained with Hematoxylin Stain Solution, Gill 3 (Ricca Chemical Company, Pocomoke City, MD) and Eosin Y (Sigma-Aldrich). Sections were dehydrated in an increasing series of ethanol baths (70%, 95%, and 100%), cleared in xylene, and mounted with Cytoseal XYL xylene-based mounting media (Thermo Fisher Scientific, Waltham, MA). The H&E stains were used for histopathological assessment.

Immunofluorescence and Immunohistochemistry Staining

Tissue fixation and stain was done as described previously.15x15Nandan, M.O., Ghaleb, A.M., Bialkowska, A.B., and Yang, V.W. Kruppel-like factor 5 is essential for proliferation and survival of mouse intestinal epithelial stem cells. Stem Cell Res. 2015;
14: 10–19
Crossref | PubMed | Scopus (14)
| Google ScholarSee all References

Table 1List of Antibodies Used in the Study
Antibody Source Catalog #
Goat polyclonal anti-KLF5 (used at 1:300) R&D Systems Cat# AF3758
Rabbit polyclonal anti-KLF5 (used at 1:300) Abcam Cat# Ab137676
Chicken polyclonal anti-GFP (used at 1:500) Aves Labs Cat# GFP-1020
Rabbit polyclonal anti-RFP (used at 1:300) Rockland Cat# 600-401-379
Goat polyclonal anti-GFP (used at 1:300) Rockland Cat# 200-101-379
Rabbit polyclonal anti-Cleaved caspase-3 (Used at 1:200) Cell Signaling Cat# 9661
Rabbit polyclonal anti-E-cadherin (Used at 1:200) Cell Signaling Cat# 3195
Rabbit polyclonal anti-Mucin 2 (Used at 1:100) Santa Cruz Biotech. Cat# SC-15334
Rabbit polyclonal anti-Chromogranin A (Used at 1:200) Abcam Cat# 1773-1
Rabbit polyclonal anti-Lysozyme (Used at 1:200) Dako Cat# A0099
Mouse monoclonal anti-Vil1 BD Bioscience Cat# 610358
AF647-conjugated goat polyclonal anti-bovine IgG (Used at 1:300) Jackson ImmunoResearch Cat# 101-605-003
Bovine polyclonal anti-goat IgG (Used at 1:300) Jackson ImmunoResearch Cat# 805-005-180
Cy3-conjugated donkey polyclonal anti-mouse IgG Jackson ImmunoResearch Cat# 715-165-150
Mouse polyclonal anti-rabbit IgG Jackson ImmunoResearch Cat# 211-005-109
AF488-conjugated donkey polyclonal anti-chicken Jackson ImmunoResearch Cat# 703-545-155
Rabbit IgG, polyclonal – isotype control Abcam Cat# ab171870


View Table in HTML

EdU and TUNEL Staining

EdU-labeled cells were stained using the Click-IT Plus EdU Imaging kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. TUNEL staining was performed according to the manufacturer’s protocol (Sigma-Aldrich).

Cell and Crypt Counting

Countable crypts were selected based on the presence of 3 to 5 Paneth cells at the bottom of the crypt using red fluorescent protein (RFP) or enhanced green fluorescent protein (EGFP) immunofluorescent staining. The numbers were represented as average number of stained cells per crypt, or percent of stained cells of total number of cells. For average number of crypt cells, a minimum of 20 crypts were counted per mouse for n = 3–4. For percent of EdU-incorporated cells, a total of 250 cells were counted per mouse for n = 3.

Cell Isolation for Enteroid Culture

Proximal small intestine was harvested from mice injected with tamoxifen for 5 consecutive days. Intestinal epithelial cells were dissociated as previously described.47x47Sato, T., Vries, R.G., Snippert, H.J., van de Wetering, M., Barker, N., Stange, D.E., van Es, J.H., Abo, A., Kujala, P., Peters, P.J., and Clevers, H. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 2009;
459: 262–265
Crossref | PubMed | Scopus (2490)
| Google ScholarSee all References

Enteroid Paraffin Section Preparation

Enteroids were washed with phosphate-buffered saline. Matrigel from multiple wells was gently scraped and dissolved with Cell Recovery Solution (Corning) on an orbital shaker (250 rpm) at 4°C for 30 minutes. Enteroids were centrifuged at 300 g for 10 minutes at 4°C, suspended in HistoGel (Thermo Fisher Scientific), moved to a disposable base mold, and placed on ice for 10 minutes. Hardened gel was fixed for 24 hours and processed for paraffin embedding.

Enteroid Whole-Mount Immunofluorescent Staining and Nuclei Quantification

Whole-mount immunofluorescent staining was performed as previously described.49x49O’Rourke, K.P., Dow, L.E., and Lowe, S.W. Immunofluorescent staining of mouse intestinal stem cells. Bio Protoc. 2016;
6: e1732
PubMed
| Google ScholarSee all References

Cell Isolation for Total RNA Analysis

Mice were injected with tamoxifen for 5 consecutive days. Proximal small intestines were harvested, and cells were isolated and dissociated as previously described.24x24Jadhav, U., Nalapareddy, K., Saxena, M., O’Neill, N.K., Pinello, L., Yuan, G.C., Orkin, S.H., and Shivdasani, R.A. Acquired tissue-specific promoter bivalency is a basis for PRC2 necessity in adult cells. Cell. 2016;
165: 1389–1400
Abstract | Full Text | Full Text PDF | PubMed | Scopus (45)
| Google ScholarSee all References

RNA Isolation and Gene Expression Analysis by RT-qPCR

Total RNA was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. RNase-Free DNase Set (Qiagen) was used to remove DNA. Total RNA was used for RT-qPCR and RNA-Sequencing. cDNA was synthesized using the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. RT-qPCR assay was performed using TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) and QuantStudio 3 qPCR machine (Thermo Fisher Scientific). List of the primers used in this study is listed in Table 2.

Table 2List of TaqMan Primers and ChIP-qPCR Primers Used in the Study
Primer Sequence/TaqMan Gene Expression Primers Catalog Number
Klf5 Cat. #: 4331182; Mm00438890_m1
Lgr5 Cat. #: 4331182; Mm00438905_m1
Ascl2 Cat. #: 4331182; Mm01268891_g1
Olfm4 Cat. #: 4331182; Mm01320260_m1
Smoc2 Cat. #: 4331182; Mm00491553_m1
Msi1 Cat. #: 4331182; Mm01203522_m1
Axin2 Cat. #: 4331182; Mm00443610_m1
Ccnd1 Cat. #: 4331182; Mm00432359_m1
Mki67 Cat. #: 4331182; Mm01278617_m1
Fabp1 Cat. #: 4453320; Mm00444340_m1
Fabp2 Cat. #: 4331182; Mm00433188_m1
VIl1 Cat. #: 4331182; Mm00494146_m1
Atoh1 Cat. #: 4448892; Mm00476035_s1
Chga Cat. #: 4448892; Mm00514341_m1
Muc2 Cat. #: 4448892; Mm01276696_m1
Lyz1 Cat. #: 4448892; Mm00657323_m1
Reg1 Cat. #: 4448892; Mm00485651_m1
Reg3b Cat. #: 4331182; Mm00440616_g1
Hes1 Cat. #: 4448892; Mm01342805_m1
Alpi Cat. #: 4448892; Mm00476035_s1
Hprt Cat. #: 4448490; Mm03024075_m1
Ascl2 Promoter F: CTGGGCACCTGTACCCATTTA
R: TCTCTCAGGTCAGGGCAACC


View Table in HTML

RNA Library Preparation and Sequencing

RNA quality (RNA Integrity Number >7.0) was measured using Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). Total 500 ng of RNA was used to prepare RNA-seq libraries. The RNA library was prepared and sequenced as previously described.50x50He, P., Yang, J.W., Yang, V.W., and Bialkowska, A.B. Kruppel-like factor 5, increased in pancreatic ductal adenocarcinoma, promotes proliferation, acinar-to-ductal metaplasia, pancreatic intraepithelial neoplasia, and tumor growth in mice. Gastroenterology. 2018;
154: 1494–1508.e13
Abstract | Full Text | Full Text PDF | PubMed | Scopus (14)
| Google ScholarSee all References

RNA-seq Analysis

The reads were aligned with STAR (version 2.4.0c),51x51Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;
29: 15–21
Crossref | PubMed | Scopus (7152)
| Google ScholarSee all References

ChIP-seq

Lgr5EGFPhi cells were collected as for ChIP-PCR. ChIP-seq was performed as in.29x29Jadhav, U., Saxena, M., O’Neill, N.K., Saadatpour, A., Yuan, G.C., Herbert, Z., Murata, K., and Shivdasani, R.A. Dynamic reorganization of chromatin accessibility signatures during dedifferentiation of secretory precursors into Lgr5+ intestinal stem cells. Cell Stem Cell. 2017;
21: 65–77.e5
Abstract | Full Text | Full Text PDF | PubMed | Scopus (67)
| Google ScholarSee all References

ChIP-seq Data Analysis

The first mates of paired-end reads were used as single-end reads for further analysis. Reads were aligned to the mouse reference genome mm9 (NCBI Build 37) or mm10 (GRCm38) using Bowtie2.57x57Langmead, B. and Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;
9: 357–359
Crossref | PubMed | Scopus (13342)
| Google ScholarSee all References

ChIP-PCR

Approximately 1 × 106 Lgr5EGFPhi cells pooled from 2–4 mice were used for ChIP-PCR. ChIP was performed as previously described,62x62Brind’Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M.M., and Lorincz, M.C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat Commun. 2015;
6: 6033
Crossref | PubMed | Scopus (115)
| Google ScholarSee all References

Luciferase Assay

RKO colorectal cancer cell line was purchased from American Type Culture Collection (CRL-2577) and cultured in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. RKO cells were transfected with pEGFP-N1 plasmids (6085-1; Clontech). The signal from EGFP is used as a control. Cells were seeded in 96-well plate at 5 × 104 cells per well. Gaussia luciferase reporter construct bearing Ascl2 promoter (MPRM39895-PG02; GeneCopoeia, Rockville, MD) was transfected with pMT3 or pMT3-KLF5-HA using Lipofectamine 2000 (Thermo Fisher Scientific), according to manufacturer’s instructions. Vectors pMT3 and pMT3-KLF5-HA were previously described.64x64Nandan, M.O., Yoon, H.S., Zhao, W., Ouko, L.A., Chanchevalap, S., and Yang, V.W. Kruppel-like factor 5 mediates the transforming activity of oncogenic H-Ras. Oncogene. 2004;
23: 3404–3413
Crossref | PubMed | Scopus (111)
| Google ScholarSee all References

Statistics

Mann-Whitney U test and linear mixed regression models were performed using GraphPad Prism version 7.0 for Windows (GraphPad Software, San Diego, CA) and SAS 9.4 (SAS Institute, Cary, NC), respectively. Log and square transformations were applied to the outcomes as needed to ensure the validity of assumptions of normal residuals for linear mixed regression models. All animal studies used tissues from at least 3 animals (n ≥ 3). To ensure quality and reproducibility of cell purification, all experiments involving FACS isolation of single Lgr5EGFP+ cells were done with at least 3 mice (n ≥ 3), with multiple individual experiments. ChIP-qPCR used approximately 1 × 106 Lgr5EGFPhi cells per sample pooled from 2–4 mice. Luciferase assay was performed with at least 7 wells per group, with multiple individual experiments. A P < .05 was considered significant.

Source Link

Related Articles

Leave a Comment

This website uses cookies to improve your experience. We will assume you are ok with this, but you can opt-out if you wish. Accept Read More

%d bloggers like this: