Home Liver Research Hepatocytes trap and silence coxsackieviruses, protecting against systemic disease in mice

Hepatocytes trap and silence coxsackieviruses, protecting against systemic disease in mice

Credits to the Source Link Daniel
Hepatocytes trap and silence coxsackieviruses, protecting against systemic disease in mice

Ethics statement

All animal experiments were approved by The Scripps Research Institute (TSRI) Institutional Animal Care and Use Committee (protocol number 09-0131-3) and were carried out in accordance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals.

Mice

CAR-floxed mice35 were a generous gift from Dr. Robert Ross at UC San Diego. CLEC4C-DTR mice24 (JAX 014176), Albumin-Cre transgenic mice36 (JAX 003574; herein, AlbCre) and IRF1KO mice37 (JAX 002762) were purchased from the Jackson laboratory. To generate CARHEPKO mice, CAR-floxed (CARf/f) mice were mated with Albumin-Cre transgenic mice (AlbCre) to generate CARf/+ AlbCre mice. The doubly mutant mice were then intercrossed to obtain CARf/f AlbCre mice (i.e., CARHEPKO mice). Mouse genotypes were assessed as shown in Fig. 1a, using the forward primer (5′CAAAGGTACCACAACCCTTG3′), and the reverse primer (5′TGTGGTGCAGGCTGTCTTCA3′). The lines were maintained by mating CARHEPKO mice with CARf/f mice to obtain additional CARHEPKO mice, as well as CARf/f Cre littermate controls, which are genetically CAR-intact. The two types of offspring were born at a ~1:1 ratio, and the mice were phenotypically indistinguishable, indicating that deletion of CAR from hepatocytes is well-tolerated; this contrasts with the effects of total CAR deletion, or deletion specifically from cardiomyocytes, both of which are embryonically lethal35,38,39. For diphtheria toxin (DT)-mediated pDC depletion models, CLEC4C-DTR(−) and CLEC4C-DTR(+) transgenic mice were injected with PBS or 2 µg of DT (Millipore SIGMA #D0564) twice (at days −1 and +1 of CVB3 infection) i.p. The DT-treated CLEC4C-DTR(+) mice were used as the pDC-depleted mice and the DT-treated CLEC4C-DTR(-) mice and the PBS-treated mice were used as the control pDC-intact mice for the pDC-depleted mice. C57BL/6 mice were purchased from the TSRI rodent breeding colony and the Jackson laboratory (JAX 000664) and used as the control wild-type for IRF1KO mice. For in vivo virus infection, the animals were bred and housed in Biosafety Level-2 (BSL-2) and only male animals were used for these studies. Each experimental group was generated by matching their ages (8–14-week old) between the groups in each experiment.

Cells

HeLa cells for plaque assays were maintained with DMEM (Life Technologies #10313-021) supplemented with 10% FBS (Omega Scientific #FB-02) and 1x Penicillin-Streptomycin-Glutamine (Thermo Fisher Scientific #10378016) in 5% CO2 incubator at 37 °C. H2.35 cells were purchased from ATCC (#CRL-1995), and were maintained in a 10% CO2 incubator at 33 °C in the following medium: DMEM, low glucose, GlutaMAX Supplement, pyruvate (Life Technologies #10567-014), supplemented with 200 nM dexamethasone (SIGMA Aldrich, #D4902), 4% FBS and 1× Penicillin-Streptomycin (Thermo Fisher Scientific #15140148). Cryopreserved C57BL/6 Mouse Hepatocytes were purchased from Lonza (#MBCP01) and were maintained with the maintain media provided by the manufacturer in 5% CO2 incubator at 37 °C. For isolation of primary hepatocytes, we modified a published procedure40, dispensing with the use of peristaltic pump perfusion. In brief, mice were sacrificed and perfused 3× with (1) Dulbecco PBS, (2) warmed Buffer 1 (142 mM NaCl, 6.7 mM KCl, 10 mM HEPES, 0.226 mM BSA, at pH 7.4) and (3) warmed Collagenase D (Roche, Cat# 11088866001) in Buffer 2 (66.74 mM NaCl, 6.71 mM KCl, 6.31 mM CaCl2, 100 mM HEPES, 0.226 mM BSA, 0.03 mM phenol red, at pH 7.4). Liver was then perfused directly via portal vein with Collagenase D in Buffer 2 allowing the solution to fill all lobes of the liver. The liver was isolated, the gall bladder was removed, and the liver was placed on a small petri dish. The liver was gently shaken, allowing the perfused fluid, plus cells, to be collected in the dish. The liver was then cut into small pieces, and the contents of the petri dish were transferred to a 25 ml Erlenmeyer flask. Oxygen (Praxair, Cat# UN1072) was added, sealed with a rubber top and parafilm and incubated on shaker at 150 rpm at 37 °C for 30 min. After digestion, cell suspension was transferred through a 70 µm strainer into a 50 ml conical tube and washed twice with warmed Buffer 3 (137 mM NaCl, 4.7 mM KCl, 0.66 mM MgSO4, 1.62 mM CaCl2, 10 mM HEPES, 0.266 mM BSA, at pH 7.4). Cells were spun at 800 rpm for 3 min after each wash, then were resuspended in hepatocyte culture media: Williams E medium, no phenol red (ThermoFisher Scientific, Cat # A1217601) supplemented with hepatocyte maintenance pack (ThermoFisher Scientific, Cat # CM4000). Cells were counted and plated onto 24-well collagen I coated plates (Corning, Cat# 354408) and maintained in a 5% CO2 incubator at 37 °C. Culture media was replaced at 24 h and 48 h post culture. After 5 days of culture, cells were used as primary hepatocytes for further applications.

Viruses

The wild-type CVB3 used in these studies is a plaque purified isolate (designated H3) of the myocarditic Woodruff variant of CVB3. Plasmid pH 3, encoding a full-length infectious clone of this virus, was provided by Dr. Kirk Knowlton (University of California, San Diego). Mice were infected intraperitoneally (i.p) with the indicated dose of CVB3 and their survival and body weight were monitored during the course of infection. Mice were bled on the indicated days p.i. and, at the end of experiment, were sacrificed, and their blood and tissues were removed for the subsequent assays.

Mouse serum samples

For serum isolation, whole blood was collected into MiniCollect serum separation gel tubes (Greiner Bio-One, #450472) and centrifuged for 10 min at 3000g room temperature. The sera were stored at −20 °C until use.

Plaque assays

Feces were collected at the indicated times p.i. At the time of sacrifice, mice were perfused with DPBS and then pancreata, livers, hearts, and small intestines were isolated, weighed, and homogenized in 1 ml Dulbecco Modified Eagle Medium (DMEM). Hepatocyte supernatants were collected at indicated time points. CVB3 plaque assays were performed as described previously41 with slight modification. Briefly, 1.7 × 105 HeLa cells were seeded 24 h prior to inoculation in a 24-well plate. 100 μl of serial diluted inoculum was added to the cell monolayers. Plates were shaken 10–15 min interval for 1 h to prevent dryness of monolayer. One hour later, inoculum was removed and cells were overlaid with DMEM containing 0.6% agar (Fisher Bioreagent #BP1423-500). 42 h post-inoculation, cells were fixed with 25% Acetic Acid (Fisher Chemical #A38SI-212)/75% Methanol (Fisher Bioreagent #BP1105-4) and stained with 0.25% Crystal Violet (SIGMA Aldrich #C0775). After washing Crystal Violet solution, plaques were counted and PFU/ml and PFU/gram were calculated based on dilution rates and tissue weigh, respectively.

CRISPR/Cas9-mediated gene editing in H2.35 cells

2 × 105 H2.35 cells were seeded onto six-well plates. 24 h later, pX459 ver 2.0 (Addgene, #62988) encoding sgCARs, or empty (control) was transfected into H2.35 cells and incubated for further 24 h. Then culture medium was changed to the media containing puromycin (2 μg/ml) and Cas9-expressing cells were selected for three days. After drug selection, puromycin was removed from culture media and cells were recovered. These bulk gene-edited cells were used for in vitro studies.

BCA assays and western blotting

Tissues were homogenized in freshly prepared RIPA buffer (EMD Millipore #20-188) containing the Protease inhibitor cocktail (Roche/Genentech #11697498001) and the Halt Phosphatase Inhibitor Cocktail (Pierce/Thermo Fisher Scientific #1862495). After centrifugation for 10 min at 4 °C, debris was discarded and protein concentration in the supernatant was determined by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific #23225). Colorimetry was measured using plate reader, Victor X3 (Perkin Elmer). Five microgram of the total cell lysates were mixed with Laemmli Sample Buffer (Bio-Rad #161-0747) and 10% of 2-Mercaptoethanol (SIGMA Aldrich #M6250), boiled at 98 °C for 5 min and used for western blotting. Transfer of the proteins to membrane was performed using Transblot Turbo RTA Transfer Kit (Bio-Rad #170-4272) as follows. After developed on SDS gels, proteins were transferred on PVDF membranes (Bio-Rad, a component of the Transfer Kit) by using Transblot Turbo system (Bio-Rad). Membranes were then blocked with 1% skim milk (EMD Millipore #115363) for an hour, and overnight with the relevant diluted primary antibodies [anti-CXADR/CAR antibody (provided by Dr. Klingel, University Hospital Tübingen, Germany), and anti-GAPDH antibody (clone 6C5), EMD Millipore #MAB374]. Then, membranes were washed three times with Tris buffer Tween 20 (TBST) and incubated with diluted secondary antibodies (HRP-conjugated donkey anti-rabbit IgG or sheep anti-mouse IgG, GE Healthcare Life Sciences #NA934 & NA931). One hour later, membranes were washed again three times with TBST, then protein–antibody complexes were visualized by Super Signal ELISA Femto Maximum Sensitivity Substrate (Thermo Scientific #37074). Images were captured with the ChemiDoc imager (Bio-Rad).

Real-time RT-PCR

RNA was isolated from tissue and cell suspensions using the RNeasy Mini Kit (QIAGEN, # 74104), and 1–2 μg of RNA was reverse transcribed using iScript Reverse Transcription supermix (Bio-rad, #1708841). Real-time PCR was performed using Power SYBR Green PCR mastermix reagent (Applied biosystems, #4367659) with specific primer sets; CVB3, Forward: CACACTCCGATCAACAGTCA and Reverse: GAACGCTTTCTCCTTCAACC. Gapdh, Forward: AGGTCGGTGTGAACGGATTTG and Reverse: TGTAGACCATGTAGTTGAGGTCA. All the values were normalized to the values of Gapdh.

Immunofluorescence, immunohistochemistry, and histological analysis

Mice were perfused with DPBS, and tissues were harvested, fixed using buffered zinc formalin at room temperature overnight. For immunofluorescence, 70 µM sections of liver were cut with a Leica VT 1000S Vibratome. For VP1, nuclei and F-Actin staining, sections were antibody-labeled using the MAX FluorTM Mouse on Mouse Fluorescent Detection kit (MaxVision Biosciences #MF01-S). Briefly, the tissue sections were washed with PBS for 5 min three times and permeabilized with 0.5% Triton/PBS for 30 min at room temperature. Then, enough Protein Blocking Solution (Reagent 1) was added and sections were incubated for 10 min at room temp. Excess Reagent 1 was removed and sections were blocked with MaxMOM Blocking reagent (Reagent 2) for 60 min at room temperature. Sections were washed with 0.3% Triton/PBS for 5 min three times. Sections were incubated with primary antibody [Mouse anti-Enterovirus VP1 (Clone 5-D8/1, Mediagnost Germany #M47) or the dsRNA-specific J2 antibody (Scicons #10010500) diluted to 1:2000 in 0.3% Triton/PBS] for one hour at room temperature and then at 4 °C overnight. Next day, sections were washed with 0.3% Triton/PBS for 5 min three times and enough Fluorescent Signal Enhancer (Reagent 3) was added and sections incubated for 30 min at room temperature. Sections were then rinsed with 0.3% Triton/PBS for 5 min three times. A working solution of concentrated Max Fluor 488 Labeled Linker (Reagent 4) diluted in Fluorescent Diluent (Reagent 5) (1:400) was added to sections and incubated in the dark for one hour at room temperature. After further washing with 0.3% Triton/PBS, sections were incubated with Alexa Fluor 568 Phalloidin (Thermo Scientific #A12380) (1:40) in PBS at 4 °C overnight to label F-actin. After incubation, sections were rinsed with PBS for 5 min three times, then counterstained with Hoechst 33342 (1:10,000) (Thermo Fisher Scientific #H3570). For oil red O staining, sections were stained using an oil red O stain kit (Abcam, #ab150678) according to the manufacturer’s instruction, then counterstained with Hoechst 33342 (1:10,000). For the other histological analyses, formalin-fixed tissues were paraffin embedded and 3 μm sections were cut. For standard histological analyses, sections were stained with Hematoxylin-Eosin. For immunohistochemistry, sections were deparaffinized with Xylene for 10 min, 100% Ethanol for 10 min, 90% ethanol for 3 min, 80% ethanol for 3 min, 70% ethanol for 3 min, then washed with TBS for 5 min. The deparaffinized sections were either incubated in 10 mM sodium citrate buffer (pH 8.34) at 80 °C for 30 min (cleaved caspase-3 staining and CAR staining) or directly subjected to TUNEL assays. For cleaved caspase-3 staining and CAR staining, Cell and Tissue Staining Kit Anti-Rabbit HRP-DAB system (R&D systems #CTS005) was used according to the manufacturer’s instructions, with either anti-cleaved caspase-3 antibody (Cell Signaling Technology #9664 T) or anti-CAR/CXADR antibody (Sinobiological #50019-R001). TUNEL assays were performed using a TUNEL Assay Kit – HRP-DAB (Abcam, #ab206386) according to the manufacturer’s instructions. All sections were mounted with ProLong Gold Antifade Mountant solution (Invitrogen #P36930) for imaging.

Imaging and analysis

Confocal images were captured using a Zeiss LSM 780 Laser Confocal Scanning Microscope running Zen 2009 Zeiss software suite. Representative regions within each vibratome section of the tissues were scanned and reconstructed for analysis. Exposure and image acquisition settings were identical for all sections. Histological images were captured with an BZ-X710 inverted microscope (KEYENCE) using BZ-X Viewer software (KEYENCE). Myocarditis in the images at x10 magnification was quantified using the particle analysis command in ImageJ software to determine the percentage area, in multiple cardiac sections, that was represented by nuclei.

Enzyme-linked immunosorbent assay (ELISA)

Serum IFN-α2/α4 levels were measured using mouse IFN-α platinum ELISA kit (Thermo Scientific #BMS 6027) according to the manufacturer’s instruction. Briefly, all tested sera were diluted in Assay Buffer (1:2, v/v). Microwell strips were washed twice, and appropriate volumes of Assay Buffer and standards/samples were added to each well. Then, Biotin-Conjugate was further added to each well, and the plate was incubated for 2 h at room temperature on a microplate shaker. After washing with Wash Buffer four times, Streptavidin-HRP was added to each well and the plate was incubated for one hour at room temperature on a microplate shaker. After washing four times, TMB Substrate Solution was added to each well and the plate was incubated for 15–30 min at room temperature in the dark. Once the colorimetric reaction in standard wells has become obvious, the reaction was stopped with Stop Solution and the color intensity was measured at 450 nm using plate reader, Victor X3 (Perkin Elmer).

Serum cytokine array

Sera from CAR WT and CARHEPKO mice were used for cytokine array. The array was performed using Proteome Profiler Mouse Cytokine Array Panel A Kit (R&D systems #ARY006) according to the manufacturer’s instruction. Briefly, membranes were blocked for one hour at room temperature. Meanwhile, samples were incubated with detection antibody for one hour at room temperature. Then, the blocked membranes were incubated in the sample/detection antibody mixtures overnight at 4 °C. Next day, the membranes were washed three times and incubated with diluted Streptavidin-HRP for 30 min. at room temperature. After washing three times, the membranes were incubated with Chemi Reagent Mix and each spot was visualized on ChemiDoc™ touch imaging system (Bio-Rad). The signal intensities of each spot were calculated using ImageJ software, and each value was normalized against the mean values of reference spots (pre-defined by the manufacturer).

ALT activity assay

Serum ALT activity was measured using the alanine aminotransferase activity colorimetric/fluorometric assay kit (BioVision, #K752-100) according to the manufacturer’s instruction. Briefly, serum samples were diluted at 1:1,000 in ALT Assay Buffer and mixed with 100 Reaction Mix. Then, the fluorescence was measured at Ex/Em = 531/595 nm using plate reader, Victor X3 (Perkin Elmer) at least two different time points. ALT activity was calculated by (B × dilution factor)/[(T2T1) × 0.02], where B is the pyruvate amount from pyruvate Standard Curve (in nmol), T1 and T2 are the time of the first and the second reading (in min), respectively, and shown as mU/ml.

Flow cytometry

To determine the surface CAR expression on hepatocytes and Kupffer cells, mice were sacrificed and perfused with DPBS. Livers were isolated, cut into small pieces and incubated in digestion solution [Collagenase D (Roche, #11088866001) 0.625 mg/ml, DNase (Sigma-Aldrich, #10104159001) 0.1 mg/ml, Collagenase V (Sigma-Aldrich, #C9263) 0.85 mg/ml, Dispase (Sigma-Aldrich, #D4693) 1 mg/ml in RPMI] by shaking at 175 rpm at 37 °C for 25 min. Then, the digested tissues were removed by a 100 µm mesh and set aside for hepatocyte analysis. Leukocytes in the flow through were washed with RPMI twice, then red blood cells were lysed with 0.83% NH4Cl. The cells were passed through a 70 µm cell strainer, treated with anti-CD16/32 (BD Biosciences #553142) for Fc-blocking, and subjected to CAR staining (below). The digested liver tissues for hepatocyte analysis were mechanically disrupted, and the cell pellets were washed twice with RPMI, then treated with Hoechst 33342 (Thermo Fisher Scientific #H3570) 15 µg/ml for 30 min on ice. After washing with FACS buffer [2% FBS (Omega Scientific #FB-02) in PBS] twice, both the Fc-blocked hepatic lymphocytes and the hepatic cell pellets were treated with either control purified mouse IgG1 (BioLegend #401402) or anti-CAR (clone RmcB) antibody (Millipore #05-644) with (Kupffer cell staining) or without (hepatocyte staining) PE-conjugated anti-F4/80 (BioLegend #123109) for 30 min on ice. After rinsing with FACS buffer twice, the cells were treated with Alexa Fluor 488-conjugated anti-mouse IgG (Thermo Fisher Scientific #A21202) for 30 min on ice. After rinsing with Wash buffer twice, the cells were resuspended in FACS buffer and analyzed. To determine the pDC population, mice were sacrificed and perfused with DPBS. Spleens and livers were isolated, cut into small pieces and incubated in Collagenase D solution [2% FBS, HG 1:100, 5 M MgCl2/CaCl2 1:500, P/S/G 1:100, Collagenase D (Roche, #11088866001) 1 mg/ml final, DNase 1:500 (20 µg/ml, Roche) in RPMI] by shaking at 180 rpm at 37 °C for 30 min. Then, the tissues were mechanically disrupted. Splenic red blood cells were lysed with 0.83% NH4Cl. Hepatic immune cells for pDC analysis were isolated using lympholite-M (Cedarlane, #CL5031) according to the manufacturer’s instruction. After rinsing with PBS several times, followed by Fc-blocking with anti-CD16/32 (BD Biosciences #553142), immune cells were immunophenotyped with PerCP-Cy5.5-conjugated anti-CD11c (eBioscience #45-0114-82), PE-conjugated anti-PDCA-1 (BioLegend #127009), and APC-conjugated anti-Siglec-H (BioLegend #129611). Samples were acquired on a BD Biosciences LSR-II and analyzed using FlowJo (Treestar). Hepatocytes were identified based on DNA content. Kupffer cells were defined as hepatic F4/80+ cells. pDCs in these studies were defined as CD11c+, PDCA-1+, and Siglec-H+ cells. Gating strategies for all the flow cytometry analyses are included in Supplementary Fig. 5.

Quantification and statistical analysis

All data were analyzed using Prism software (GraphPad Prism 7/8). The two-tailed Mann–Whitney test was used to analyze differences in viral burden. Kaplan–Meier survival curves were analyzed by the log rank test. The two-tailed student’s t-test was used to analyze differences in CVB3 RNA replication, body weight loss, nuclei area quantitation, serum IFN-α levels, and serum ALT activity levels. P values less than 0.05 were considered significant and are indicated in figures as follows: * 0.05 > p > 0.01; ** 0.01 ≥ p > 0.001; *** 0.001 ≥ p > 0.0001; **** p ≤ 0.0001.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Source Link

Related Articles

Leave a Comment

This website uses cookies to improve your experience. We will assume you are ok with this, but you can opt-out if you wish. Accept Read More

%d bloggers like this: